Top » Catalog » R1b » A359

$18.00

A359
[A359]

A359
hg38 Position: ChrY:15967111..15967111
Ancestral: T
Derived: A
Reference: Walter Freeman (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC4087
Forward Primer: A359_F CCCACAACATTTGAGAGCTG
Reverse Primer: A359_R AAGGAAAAAGTTTATGTTGACACTTG
Reviews

Customers who bought this product also purchased
M222
M222
Z2980
Z2980
A725
A725
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
FGC5864
FGC5864
FGC5856
FGC5856
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A743
1 x A235
1 x A777
1 x A1077
1 x A505
1 x A603
$108.00
Haplogroup Info
Other products
Currencies