Top » Catalog » R1b » A359

$18.00

A359
[A359]

A359
hg38 Position: ChrY:15967111..15967111
Ancestral: T
Derived: A
Reference: Walter Freeman (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC4087
Forward Primer: A359_F CCCACAACATTTGAGAGCTG
Reverse Primer: A359_R AAGGAAAAAGTTTATGTTGACACTTG
Reviews

Customers who bought this product also purchased
M222
M222
Z2980
Z2980
FGC5856
FGC5856
FGC12948
FGC12948
FGC4077
FGC4077
A725
A725
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A663
1 x A418
1 x A1010
1 x A791
1 x A558
1 x A1231
1 x A2160
1 x A714
1 x A958
1 x A604
1 x A304
1 x A778
1 x A788
1 x A743
1 x A649
1 x A44
$288.00
Haplogroup Info
Other products
Currencies