Top » Catalog » R1b » A360

$18.00

A360
[A360]

A360
hg38 Position: ChrY:15986314..15986314
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC4087
Forward Primer: A360_F TCCTAAACTCAAGTGACCTCTCTG
Reverse Primer: A360_R TTAAAGGCTCTAATAGGGCAACC
Reviews

Customers who bought this product also purchased
DF85
DF85
A7410
A7410
L21
L21
A259
A259
DF13
DF13
A223
A223
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A898
1 x A346
$36.00
Haplogroup Info
Other products
Currencies