Top » Catalog » R1b » A362

$18.00

A362
[A362]

A362
hg38 Position: ChrY:20463362..20463362
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC4087
Forward Primer: A362_F TGTTACCCTTTCCCTTGACTG
Reverse Primer: A362_R AAAGCCAAGGGTTTTCCATC
Reviews

Customers who bought this product also purchased
A365
A365
Wish a SNP
Wish a SNP
A364
A364
A363
A363
A361
A361
A360
A360
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies