Top » Catalog » R1b » A362

$18.00

A362
[A362]

A362
hg38 Position: ChrY:20463362..20463362
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC4087
Forward Primer: A362_F TGTTACCCTTTCCCTTGACTG
Reverse Primer: A362_R AAAGCCAAGGGTTTTCCATC
Reviews

Customers who bought this product also purchased
A363
A363
A361
A361
A360
A360
M4491
M4491
A359
A359
A365
A365
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies