Top » Catalog » R1b » A363

$18.00

A363
[A363]

A363
hg38 Position: ChrY:2894703..2894703
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC4087
Forward Primer: A363_F CCTACTGCCTTCTGGTTTGC
Reverse Primer: A363_R ACCCAAAGAGACCCACTCAG
Reviews

Customers who bought this product also purchased
S588
S588
DF49
DF49
FGC4078
FGC4078
FGC5864
FGC5864
FGC440
FGC440
FGC4077
FGC4077
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies