Top » Catalog » R1b » A363

$18.00

A363
[A363]

A363
hg38 Position: ChrY:2894703..2894703
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC4087
Forward Primer: A363_F CCTACTGCCTTCTGGTTTGC
Reverse Primer: A363_R ACCCAAAGAGACCCACTCAG
Reviews

Customers who bought this product also purchased
S588
S588
DF49
DF49
M222
M222
FGC456
FGC456
FGC4087
FGC4087
FGC12948
FGC12948
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies