Top » Catalog » R1b » A364

$18.00

A364
[A364]

A364
hg38 Position: ChrY:7044916..7044916
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC4087
Forward Primer: A364_F GGACAGGGTCTCACTCAGTCAC
Reverse Primer: A364_R TGCGCAGGGTAACTTGAAG
Reviews

Customers who bought this product also purchased
A363
A363
A362
A362
A361
A361
A360
A360
M4491
M4491
A359
A359
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies