Top » Catalog » R1b » A364

$18.00

A364
[A364]

A364
hg38 Position: ChrY:7044916..7044916
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC4087
Forward Primer: A364_F GGACAGGGTCTCACTCAGTCAC
Reverse Primer: A364_R TGCGCAGGGTAACTTGAAG
Reviews

Customers who bought this product also purchased
A360
A360
M4491
M4491
A359
A359
A365
A365
Wish a SNP
Wish a SNP
A363
A363
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A225
1 x A902
1 x A1259
1 x A1537
1 x A419
1 x A2219
1 x A603
1 x A777
1 x A206
$162.00
Haplogroup Info
Other products
Currencies