Top » Catalog » R1b » A365

$18.00

A365
[A365]

A365
hg38 Position: ChrY:8364122..8364122
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC4087
Forward Primer: A365_F CCTACAAACCTTACAGCCAAGG
Reverse Primer: A365_R AATATTGAAGGGCCATTGTCC
Reviews

Customers who bought this product also purchased
A364
A364
Wish a SNP
Wish a SNP
A363
A363
A362
A362
A361
A361
A360
A360
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A642
1 x A242
1 x A1162
1 x A2256
1 x A432
$90.00
Haplogroup Info
Other products
Currencies