Top » Catalog » R1b » A523

$18.00

A523
[A523]

A523
hg38 Position: ChrY:11890079..11890079
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1b1a1
Comments: Downstream L257 > Z8190 > Z375 > Z8191 > S5739 > S5443 > A512
Forward Primer: A523_F GTCCAATTAGGAGGTAGACACGTC
Reverse Primer: A523_R TCTTGATGTTCCTTCACTCTTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies