Top » Catalog » R1b » A387

$18.00

A387
[A387]

A387
hg38 Position: ChrY:8565817..8565817
Ancestral: T
Derived: G
Reference: Stephan Frank (2014)
ISOGG Haplogroup: R1b1a2a1a1c2b2a1a1b2 (not listed)
Comments: Aka FGC15259
Forward Primer: A387_F AGGCATATGACCCAGAGGTG
Reverse Primer: A387_R TGCCCAGTCATTAAAACGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A532
$18.00
Haplogroup Info
Other products
Currencies