Top » Catalog » R1b » A388

$18.00

A388
[A388]

A388
hg38 Position: ChrY:14162872..14162872
Ancestral: C
Derived: T
Reference: Stephan Frank (2014)
ISOGG Haplogroup: R1b1a2a1a1c2b2a1a1b2 (not listed)
Comments: Aka FGC15260
Forward Primer: A388_F GAGATGGCCAGGTGATTCTAC
Reverse Primer: A388_R CAGTCCTTCAAGGAGTACTACTTTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A694
$18.00
Haplogroup Info
Other products
Currencies