Top » Catalog » R1b » A389

$18.00

A389
[A389]

A389
hg38 Position: ChrY:17265841..17265841
Ancestral: A
Derived: G
Reference: Stephan Frank (2014)
ISOGG Haplogroup: R1b1a2a1a1c2b2a1a1b2 (not listed)
Comments: Aka FGC15261
Forward Primer: A389_F GCTAGGTATGGTGGCTCAGG
Reverse Primer: A389_R AAGAAATGCAATGTTAAAATGGATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A761
1 x A142
1 x A654
1 x A2117
1 x A48
1 x A961
1 x A2183
1 x A858
1 x A1232
1 x A347
1 x A730
1 x A46
1 x A1197
1 x A898
1 x A2077
1 x A1251
1 x A228
$306.00
Haplogroup Info
Other products
Currencies