Top » Catalog » R1b » A390

$18.00

A390
[A390]

A390
hg38 Position: ChrY:19697907..19697907
Ancestral: T
Derived: C
Reference: Stephan Frank (2014)
ISOGG Haplogroup: R1b1a2a1a1c2b2a1a1b2 (not listed)
Comments: Aka FGC15262
Forward Primer: A390_F TTAAAACAGGGGGCAGATTC
Reverse Primer: A390_R GAGTGCTTAATTGGTGGTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A458
$18.00
Haplogroup Info
Other products
Currencies