Top » Catalog » R1b » A391

$18.00

A391
[A391]

A391
hg38 Position: ChrY:20565707..20565707
Ancestral: T
Derived: N
Reference: Stephan Frank (2014)
ISOGG Haplogroup: R1b1a2a1a1c2b2a1a1b2 (not listed)
Comments: .
Forward Primer: A391_F CATCCCATGGAACATATGAGAG
Reverse Primer: A391_R TGCGCATGATAATGATAACCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies