Top » Catalog » R1b » A392

$18.00

A392
[A392]

A392
hg38 Position: ChrY:21370148..21370148
Ancestral: T
Derived: C
Reference: Stephan Frank (2014)
ISOGG Haplogroup: R1b1a2a1a1c2b2a1a1b2 (not listed)
Comments: Aka FGC15264
Forward Primer: A392_F CATAATAAATGTAAATGATCTAAACTCACCC
Reverse Primer: A392_R ACATCTGGGCACACAGTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1343
1 x A1234
1 x A1049
1 x A714
1 x A337
1 x A1323
$108.00
Haplogroup Info
Other products
Currencies