Top » Catalog » R1b » A410

$18.00

A410
[A410]

A410
hg38 Position: ChrY:12929780..12929780
Ancestral: T
Derived: C
Reference: Joe Fox (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2a~
Comments: Approx. R-L1/S26
Forward Primer: A410_F TTTTTCTTTGGTACAGGCACAG
Reverse Primer: A410_R TGGAATGATTAGAGATAGTTGGAAATC
Reviews

Customers who bought this product also purchased
A680
A680
Z18
Z18
FGC13326
FGC13326
S6961
S6961
U106
U106
DF96
DF96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies