Top » Catalog » R1b » A411

$18.00

A411
[A411]

A411
hg38 Position: ChrY:14628789..14628789
Ancestral: T
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2a~
Comments: Approx. R-L1/S26
Forward Primer: A411_F TCTATAAATGGTTGAGCTGTGTCC
Reverse Primer: A411_R AGAATTCTTTGAACCCAGAAAGTC
Reviews

Customers who bought this product also purchased
A531
A531
A410
A410
A415
A415
A412
A412
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A128
1 x A2164
1 x A1017
$54.00
Haplogroup Info
Other products
Currencies