Top » Catalog » R1b » A412

$18.00

A412
[A412]

A412
hg38 Position: ChrY:19445810..19445810
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2a~
Comments: Approx. R-L1/S26
Forward Primer: A412_F GGGAAACTGGAGAGAGAAGAATG
Reverse Primer: A412_R GTCTACCACAATCCCCACCA
Reviews

Customers who bought this product also purchased
A531
A531
A415
A415
A411
A411
A410
A410
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A162
1 x A886
$36.00
Haplogroup Info
Other products
Currencies