Top » Catalog » R1b » A415

$18.00

A415
[A415]

A415
hg38 Position: ChrY:21153242..21153242
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2a~
Comments: Approx. R-L1/S26
Forward Primer: A415_F CTTGAACACCTCACTGCCTG
Reverse Primer: A415_R TGCTCCTCCATCCTTTTCTTC
Reviews

Customers who bought this product also purchased
U106
U106
DF96
DF96
A226
A226
L48
L48
DF98
DF98
S1791
S1791
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies