Top » Catalog » R1b » A415

$18.00

A415
[A415]

A415
hg38 Position: ChrY:21153242..21153242
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2a~
Comments: Approx. R-L1/S26
Forward Primer: A415_F CTTGAACACCTCACTGCCTG
Reverse Primer: A415_R TGCTCCTCCATCCTTTTCTTC
Reviews

Customers who bought this product also purchased
Z381
Z381
S11515
S11515
A680
A680
Z18
Z18
FGC13326
FGC13326
S6961
S6961
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies