Top » Catalog » R1b » A415

$18.00

A415
[A415]

A415
hg38 Position: ChrY:21153242..21153242
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2a~
Comments: Approx. R-L1/S26
Forward Primer: A415_F CTTGAACACCTCACTGCCTG
Reverse Primer: A415_R TGCTCCTCCATCCTTTTCTTC
Reviews

Customers who bought this product also purchased
S1791
S1791
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Z301
Z301
L1
L1
A671
A671
Z381
Z381
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies