Top » Catalog » R1b » A1723

$18.00

A1723
[A1723]

A1723
hg38 Position: ChrY:19574940..19574940
Ancestral: T
Derived: G
Reference: Terry Barton (2015)
ISOGG Haplogroup: R1b1a2a1a2b1b (not listed)
Comments: Approximately L196
Forward Primer: A1723_F CTGATTCTTTTGCTGCCAAG
Reverse Primer: A1723_R CAAAAGACCCTGCAGTGATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A861
1 x A928
1 x A154
1 x A256
$72.00
Haplogroup Info
Other products
Currencies