Top » Catalog » R1b » A418

$18.00

A418
[A418]

A418
hg38 Position: ChrY:12153877..12153877
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A418v2_F AATTGAGCAAGCAGAGGATACAG
Reverse Primer: A418v2_R GTATTTCACATTTTGGCTGCTG
Reviews

Customers who bought this product also purchased
FGC3903
FGC3903
FGC3213
FGC3213
L1446
L1446
A5409
A5409
R1b-DF21 Panel
R1b-DF21 Panel
L1403
L1403
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies