Top » Catalog » R1b » A418

$18.00

A418
[A418]

A418
hg38 Position: ChrY:12153877..12153877
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A418v2_F AATTGAGCAAGCAGAGGATACAG
Reverse Primer: A418v2_R GTATTTCACATTTTGGCTGCTG
Reviews

Customers who bought this product also purchased
FGC3903
FGC3903
S5488
S5488
L658
L658
DF5
DF5
CTS3655
CTS3655
FGC3213
FGC3213
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A336
$18.00
Haplogroup Info
Other products
Currencies