Top » Catalog » R1b » A419

$18.00

A419
[A419]

A419
hg38 Position: ChrY:8202948..8202948
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A419_F CAATGTTACCCTTTCCTACAGCT
Reverse Primer: A419_R TGAATTCCCAAGAGCTGAGC
Reviews

Customers who bought this product also purchased
A712
A712
A682
A682
A423
A423
Z16266
Z16266
R1b-L1402/3 downstream
R1b-L1402/3 downstream
A422
A422
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies