Top » Catalog » R1b » A419

$18.00

A419
[A419]

A419
hg38 Position: ChrY:8202948..8202948
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A419_F CAATGTTACCCTTTCCTACAGCT
Reverse Primer: A419_R TGAATTCCCAAGAGCTGAGC
Reviews

Customers who bought this product also purchased
A712
A712
A682
A682
A418
A418
A424
A424
Z16837
Z16837
A385
A385
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1096
1 x A1315
1 x A2127
1 x A2251
1 x A953
$90.00
Haplogroup Info
Other products
Currencies