Top » Catalog » R1b » A420

$18.00

A420
[A420]

A420
hg38 Position: ChrY:14919967..14919967
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A420_F AACCATGGGTGTCGTTAACC
Reverse Primer: A420_R AGGTGCCTGGAAATTACCG
Reviews

Customers who bought this product also purchased
A712
A712
A682
A682
R1b-L1402/3 downstream
R1b-L1402/3 downstream
A422
A422
CTS8704
CTS8704
A421
A421
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies