Top » Catalog » R1b » A420

$18.00

A420
[A420]

A420
hg38 Position: ChrY:14919967..14919967
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A420_F AACCATGGGTGTCGTTAACC
Reverse Primer: A420_R AGGTGCCTGGAAATTACCG
Reviews

Customers who bought this product also purchased
A712
A712
A682
A682
A418
A418
A424
A424
Z16837
Z16837
A385
A385
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies