Top » Catalog » R1b » A421

$18.00

A421
[A421]

A421
hg38 Position: ChrY:17423309..17423309
Ancestral: T
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1g2a1a3a1
Comments: .
Forward Primer: A421_F CAAAATAGCCATTGAATGGCA
Reverse Primer: A421_R AGCTATTAGCACAGCCGCTG
Reviews

Customers who bought this product also purchased
S5488
S5488
L658
L658
DF5
DF5
CTS3655
CTS3655
FGC3213
FGC3213
L1446
L1446
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A935
1 x A37
1 x A1315
$54.00
Haplogroup Info
Other products
Currencies