Top » Catalog » R1b » A421

$18.00

A421
[A421]

A421
hg38 Position: ChrY:17423309..17423309
Ancestral: T
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1g2a1a3a1
Comments: .
Forward Primer: A421_F CAAAATAGCCATTGAATGGCA
Reverse Primer: A421_R AGCTATTAGCACAGCCGCTG
Reviews

Customers who bought this product also purchased
R1b-DF21 Panel
R1b-DF21 Panel
L1403
L1403
A818
A818
Z3004
Z3004
L1402
L1402
S5488
S5488
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A459
$18.00
Haplogroup Info
Other products
Currencies