Top » Catalog » R1b » A421

$18.00

A421
[A421]

A421
hg38 Position: ChrY:17423309..17423309
Ancestral: T
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1g2a1a3a1
Comments: .
Forward Primer: A421_F CAAAATAGCCATTGAATGGCA
Reverse Primer: A421_R AGCTATTAGCACAGCCGCTG
Reviews

Customers who bought this product also purchased
DF5
DF5
CTS3655
CTS3655
FGC3213
FGC3213
L1446
L1446
A5409
A5409
R1b-DF21 Panel
R1b-DF21 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1343
1 x A1234
1 x A1049
1 x A714
$72.00
Haplogroup Info
Other products
Currencies