Top » Catalog » R1b » A424

$18.00

A424
[A424]

A424
hg38 Position: ChrY:19356017..19356017
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A424_F TGCCACTACCACTTGCTCAC
Reverse Primer: A424_R TGCTAAGTGGTTTCCCAAGTG
Reviews

Customers who bought this product also purchased
A712
A712
A682
A682
Z16837
Z16837
A419
A419
Z16266
Z16266
A418
A418
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A57
1 x A674
1 x A1026
$54.00
Haplogroup Info
Other products
Currencies