Top » Catalog » R1b » A424

$18.00

A424
[A424]

A424
hg38 Position: ChrY:19356017..19356017
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A424_F TGCCACTACCACTTGCTCAC
Reverse Primer: A424_R TGCTAAGTGGTTTCCCAAGTG
Reviews

Customers who bought this product also purchased
A712
A712
A682
A682
A421
A421
Z16840
Z16840
A420
A420
Z16837
Z16837
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies