Top » Catalog » R1b » A424

$18.00

A424
[A424]

A424
hg38 Position: ChrY:19356017..19356017
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A424_F TGCCACTACCACTTGCTCAC
Reverse Primer: A424_R TGCTAAGTGGTTTCCCAAGTG
Reviews

Customers who bought this product also purchased
A712
A712
A682
A682
Z16266
Z16266
A418
A418
CTS8704
CTS8704
R1b-L1402/3 downstream
R1b-L1402/3 downstream
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies