Top » Catalog » R1b » A425

$18.00

A425
[A425]

A425
hg38 Position: ChrY:15987662..15987662
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF5 > A426 > A1344
Forward Primer: A425_F GCAGCAGCACTTACGAATTTC
Reverse Primer: A425_R CATGAAGTATAGTATGGAAAACCAATC
Reviews

Customers who bought this product also purchased
FGC28340
FGC28340
A712
A712
A682
A682
A418
A418
CTS8704
CTS8704
R1b-L1402/3 downstream
R1b-L1402/3 downstream
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A443
1 x A2142
1 x A1297
$54.00
Haplogroup Info
Other products
Currencies