Top » Catalog » R1b » A425

$18.00

A425
[A425]

A425
hg38 Position: ChrY:15987662..15987662
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF5 > A426 > A1344
Forward Primer: A425_F GCAGCAGCACTTACGAATTTC
Reverse Primer: A425_R CATGAAGTATAGTATGGAAAACCAATC
Reviews

Customers who bought this product also purchased
FGC28340
FGC28340
A712
A712
A682
A682
Z16266
Z16266
A418
A418
CTS8704
CTS8704
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2226
$18.00
Haplogroup Info
Other products
Currencies