Top » Catalog » R1b » A426

$18.00

A426
[A426]

A426
hg38 Position: ChrY:7895064..7895064
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1g2a1a3a2
Comments: .
Forward Primer: A426_F TGGCTACTTGGTACTTCTTGCA
Reverse Primer: A426_R TCTTCTTTATAGATGTCACTCACATAGC
Reviews

Customers who bought this product also purchased
S5488
S5488
DF5
DF5
FGC3213
FGC3213
A5409
A5409
A818
A818
Z3004
Z3004
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A907
1 x A62
1 x A71
1 x A214
$72.00
Haplogroup Info
Other products
Currencies