Top » Catalog » R1b » A430

$18.00

A430
[A430]

A430
hg38 Position: ChrY:8316158..8316158
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A430_F GCTCACAGCAGCTTAGAACACC
Reverse Primer: A430_R GACACACTCTACAACATTCAGAGTG
Reviews

Customers who bought this product also purchased
BY17769
BY17769
A6308
A6308
R1b-Z255 Panel
R1b-Z255 Panel
A816
A816
A1247
A1247
A1154
A1154
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2194
1 x A887
1 x A987
1 x A2201
1 x A458
1 x A189
1 x A1729
1 x A560
1 x A2070
1 x A669
1 x A411
1 x A923
1 x A321
1 x A217
1 x A613
1 x A992
1 x A1541
1 x A891
1 x A535
$342.00
Haplogroup Info
Other products
Currencies