Top » Catalog » R1b » A148

$18.00

A148
[A148]

A148
hg38 Position: ChrY:9240658..9240658
Ancestral: T
Derived: A
Reference: YFull (2014)
ISOGG Haplogroup: R1b1a2a1a2c1h (not listed)
Comments: Aka YFS066623 found in a R1b-L371 person
Forward Primer: A148_F TTGCAACTGTCTTCACTGCAG
Reverse Primer: A148_R CTATGGGAGACTGGGCCTC
Reviews

Customers who bought this product also purchased
FGC10060
FGC10060
FGC10073
FGC10073
FGC10037
FGC10037
FGC10054
FGC10054
FGC10071
FGC10071
R1b-L371 Group Panel B
R1b-L371 Group Panel B
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies