Top » Catalog » R1b » A461

$18.00

A461
[A461]

A461
hg38 Position: ChrY:12127503..12127503
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A461_F GAAGACTAACAAGCTTTACTGATGATAG
Reverse Primer: A461_R GACAGAACCAAAGTTATAGGTAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2210
1 x A974
1 x A555
1 x A1190
1 x A136
1 x A176
1 x A664
1 x A99
1 x A349
1 x A1000
1 x A1334
1 x A354
$216.00
Haplogroup Info
Other products
Currencies