Top » Catalog » R1b » A462

$18.00

A462
[A462]

A462
hg38 Position: ChrY:13078658..13078658
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A462_F CTCAGCCGATTTTGGTAATTG
Reverse Primer: A462_R CAAAATGTGGTCTATACATGCAGTAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A694
$18.00
Haplogroup Info
Other products
Currencies