Top » Catalog » R1b » A463

$18.00

A463
[A463]

A463
hg38 Position: ChrY:13362570..13362570
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A463_F TTAAGTGAGGCAATAACCAGTGTC
Reverse Primer: A463_R ATTTAAGGCATTGGGGTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A247
1 x A315
1 x A1504
1 x A353
1 x A593
1 x A172
1 x A730
$126.00
Haplogroup Info
Other products
Currencies