Top » Catalog » R1b » A465

$18.00

A465
[A465]

A465
hg38 Position: ChrY:14277142..14277142
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A465_F ATGTACCTACAAATTAAGGAGGCAC
Reverse Primer: A465_R GCATGTGCACTTTGATGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies