Top » Catalog » R1b » A465

$18.00

A465
[A465]

A465
hg38 Position: ChrY:14277142..14277142
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A465_F ATGTACCTACAAATTAAGGAGGCAC
Reverse Primer: A465_R GCATGTGCACTTTGATGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A663
1 x A418
1 x A1010
1 x A791
1 x A558
1 x A1231
1 x A2160
1 x A714
1 x A958
1 x A604
1 x A304
1 x A778
1 x A788
1 x A743
1 x A649
1 x A44
1 x A1298
1 x A362
1 x A624
1 x A672
1 x A2206
$378.00
Haplogroup Info
Other products
Currencies