Top » Catalog » R1b » A466

$18.00

A466
[A466]

A466
hg38 Position: ChrY:15318995..15318995
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A466_F ATCTGTATGGTCCTGGAATTCC
Reverse Primer: A466_R GAACTGAAGGAGATAGAAACAACAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A514
1 x A1185
1 x A30
1 x A1333
1 x A98
1 x A138
1 x A1175
1 x A1783
1 x A991
1 x A1492
1 x A2152
1 x A474
1 x A804
1 x A388
1 x A2222
1 x A81
$288.00
Haplogroup Info
Other products
Currencies