Top » Catalog » R1b » A468

$18.00

A468
[A468]

A468
hg38 Position: ChrY:16131407..16131407
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A468_F AAAAGGTGGTTTAATAGTTAGCTGTG
Reverse Primer: A468_R AAGGCTTTATTAGCTTCATAAAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1075
1 x A58
1 x A664
1 x A975
1 x A217
$90.00
Haplogroup Info
Other products
Currencies