Top » Catalog » R1b » A469

$18.00

A469
[A469]

A469
hg38 Position: ChrY:19299021..19299021
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A469_F ACCTCTTGTAGGGAGATCACATG
Reverse Primer: A469_R CAGTACAGGGGTTTGGAGAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2147
1 x A1242
1 x A2200
1 x A2261
1 x A43
$90.00
Haplogroup Info
Other products
Currencies