Top » Catalog » R1b » A469

$18.00

A469
[A469]

A469
hg38 Position: ChrY:19299021..19299021
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A469_F ACCTCTTGTAGGGAGATCACATG
Reverse Primer: A469_R CAGTACAGGGGTTTGGAGAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A121
1 x A1321
1 x A1544
1 x A2143
1 x A765
1 x A1164
1 x A682
1 x A636
1 x A326
1 x A190
1 x A227
1 x A443
1 x A660
1 x A300
1 x A1223
1 x A20
1 x A412
1 x A2181
1 x A971
1 x A154
1 x A953
1 x A218
1 x A768
1 x A130
1 x A236
1 x A336
1 x A2182
1 x A1331
1 x A732
1 x A908
1 x A78
$558.00
Haplogroup Info
Other products
Currencies