Top » Catalog » R1b » A470

$18.00

A470
[A470]

A470
hg38 Position: ChrY:20688571..20688571
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A470_F TTTTAGCTTCAAGTCTTCCAAAAG
Reverse Primer: A470_R TTTGGGAAGGGGATGAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies