Top » Catalog » R1b » A474

$18.00

A474
[A474]

A474
hg38 Position: ChrY:7436816..7436816
Ancestral: C
Derived: A
Reference: Lance Brown (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a2a1a
Comments: Found in a R1b-CTS4466 person. Aka LLB17142
Forward Primer: LLB17142_F GGATATTTTAACACGGGTCATTTG
Reverse Primer: LLB17142_R GGACAACAGGCACCTACCAC
Reviews

Customers who bought this product also purchased
A541
A541
S1115
S1115
A1336
A1336
A1337
A1337
A761
A761
A195
A195
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies