Top » Catalog » R1b » A475

$18.00

A475
[A475]

A475
hg38 Position: ChrY:7802708..7802708
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A475_F AATATAGCCATGCCCACTATATTG
Reverse Primer: A475_R CCAAAATTCCCCAAGTGTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A128
1 x A2164
1 x A1017
1 x A1301
1 x A1101
1 x A1315
1 x A1202
1 x A1286
1 x A473
1 x A233
1 x A822
1 x A89
1 x A1053
1 x A2124
1 x A341
1 x A148
1 x A716
1 x A287
$324.00
Haplogroup Info
Other products
Currencies