Top » Catalog » R1b » A476

$18.00

A476
[A476]

A476
hg38 Position: ChrY:7030375..7030375
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1e~
Comments: Downstream of A430
Forward Primer: A476_F AACTAAGGCGGAGGCAAGAC
Reverse Primer: A476_R TGGAGTCTACCCACCAGAGG
Reviews

Customers who bought this product also purchased
BY17769
BY17769
A6308
A6308
R1b-Z255 Panel
R1b-Z255 Panel
A816
A816
A1247
A1247
A1154
A1154
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2142
1 x A1314
$36.00
Haplogroup Info
Other products
Currencies